Prev: Paypal refund fees ?
Next: Scream, help and panic, Vinyl collection.
From: Phister on 27 Jun 2010 09:29
I have had a Paypal account for a number of years, but never used it. I
ordered something from a website recently that normally uses WorldPay.
Anyway throughout the transaction I was being steered to Paypal but carried
on trying to avoid logging into Paypal because I had actually forgotten my
password. I used my debit account details to complete the purchase but my
efforts of avoidance were useless, I immediately got a receipt from
Paypal...........the only hint of this coercion was when on one of the
previous pages it said that it had been detected that I had a Paypal
account.

Does this now meaan I have to have money in this Paypal account, or does it
just link directly to my debit account.........?


Regards

--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT


From: Conor on 27 Jun 2010 09:55
On 27/06/2010 14:29, Phister wrote:
> I have had a Paypal account for a number of years, but never used it. I
> ordered something from a website recently that normally uses WorldPay.
> Anyway throughout the transaction I was being steered to Paypal but carried
> on trying to avoid logging into Paypal because I had actually forgotten my
> password. I used my debit account details to complete the purchase but my
> efforts of avoidance were useless, I immediately got a receipt from
> Paypal...........the only hint of this coercion was when on one of the
> previous pages it said that it had been detected that I had a Paypal
> account.
>
> Does this now meaan I have to have money in this Paypal account, or does it
> just link directly to my debit account.........?
>
>
> Regards
>
It just takes out what is needed. If you'd have read the FAQ on Paypal's
website, you'd know this.

--
Conor www.notebooks-r-us.co.uk
From: Phister on 27 Jun 2010 11:37
I have no intention of using Paypal again. I will just have to be careful
what suppliers I use.

--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT


 | 
Pages: 1
Prev: Paypal refund fees ?
Next: Scream, help and panic, Vinyl collection.