From: Fran on

"Niel J Humphreys" <admin(a)sznzozwdzoznzczozmzpzuztzezrzs.co.uk> wrote in
message news:hej54o$1vud$1(a)energise.enta.net...

>
> Not really the done thing but neither would be the seller refunding and
> then the buyer refusing to cancel the deal meaning the seller would have
> to pay the Ebay commission on money they have not had. This would be
> un-appealable even though there would be a refund on record and something
> Ebay needs to address to avoid some sellers feeling the need to do this to
> protect their fee refunds.

The Amazon model protects the seller far better. You, the seller, simply
cancel the order before any payment is made or taken from the buyer. That
automatically reverses out all fees in full. It does ding one of your seller
metrics, potentially, but even that doesn't necessarily cause any harm. The
buyer can still leave feedback if they are so inclined, but if you handle
things properly, that can be a positive.


From: Phister on
Clearly a breach of contract, with a loss to the buyer.

--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT


From: Moog on
On Tue, 24 Nov 2009 23:15:00 +0000, Toxic Waste wrote:

<snip>
> Any thoughts on my position?
>
> Should I start a dispute or just give up, as it's a Platinum seller and
> Ebay will automatically side with them?

Start a dispute. Ebay will side with you.

However, you *know* they made a mistake. Let them graciously bow out of
it. One day you may well be in a similar position.

There's too much "me, me, me" in the world today. We are humans, not
f*cking calculators.

Think on. Stop being a selfsh clunt.

Trust me. You'll feel better for it. Breadhead.

--
Moog

"Some mornings it doesn't seem worth it to gnaw through
the leather straps"
From: Kim Andrews on
In article <UNZOm.8415$Ym4.3942(a)text.news.virginmedia.com>, "Toxic
Waste" says...

> Any thoughts on my position?
>
> Should I start a dispute or just give up, as it's a Platinum seller and Ebay
> will automatically side with them?

If the seller's messed up, they have a clear choice of suck it up and
sell anyway, or grovel. They don't seem to want to do either. :o) You,
however, can't *force* them sell to you by any practical means, so I'd
say get your cash back by whatever means is fastest, neg them and move
on.

They made a mistake, they have to live with the results. We all do. If I
make a mistake, I try to put it right, and if that doesn't work, I beg.
;o) If the begging doesn't win over the buyer and I get a neg, I'll
respond with calm explanation and try not to do it again.


--
Cheers, Kimbo

Books, by Kimbo!
Used and collectible books at sensible prices.
Buy direct at www.booksbykimbo.com
Find me on Ebid http://uk.ebid.net/stores/Books-by-Kimbo
From: Nick on

"Toxic Waste" <Trabant Owners Club(a)nicksplace.co.com> wrote in message
news:UNZOm.8415$Ym4.3942(a)text.news.virginmedia.com...
> About 4 weeks ago I purchased 25 items on a BIN from a Platinum seller
> which I considered cheap.
>
> I then received the customary "good news, you are the successful bidder
> email".
>
> This was followed by the "Thank you for your payment" email.
>
> Then, the following day, I receive an email stating there had been a
> "huge" pricing error and would I cancel the purchase.
>
> While I was contemplating my position, another email arrived saying the
> items had been dispatched.
>
> This was followed by an email asking why I had not responded to their
> request to cancel the order. I reminded them, they had sent an email
> stating the items had been dispatched.
>
> I receive another email saying the dispatch notification was yet another
> mistake.
>
> I've offered the compromise, of them sending me 40% other original order,
> which they have refused to do.
>
> Emails have been flying back and forth in an effort to settle this
> amicably, however, they refuse to budge.
>
>
> Any thoughts on my position?
>
> Should I start a dispute or just give up, as it's a Platinum seller and
> Ebay will automatically side with them?
>
> Cheers all
>
> tox
>
>
It's your call whether to start a dispute or not.
Platinum seller is V roughly defined as balls as it is, after all, ebay
terminology.
How much do you value the purchase and how much time are you willing to
spend in pursuing it?
Unless it is really very important or good, I would fear that you may be
onto a loser.
Shame, but that's ebay.
Nick.