Prev: Original photo of different item?
Next: Turbo Lister, advice please
From: Phister on 11 Jul 2010 15:01

Good article on uk.legal...Snowdon Computers gets a mention.


--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT


From: Niel Humphreys on 11 Jul 2010 16:05
"Phister" <phister(a)inbox.com> wrote in message
news:7rCdnUWNQ4WbiKfRnZ2dnUVZ7sidnZ2d(a)bt.com...
>
> Good article on uk.legal...Snowdon Computers gets a mention.

Indeed, I did a thread about this at the time on UAC.

Upshot is I sold a PC with Windows XP which had the relevent COA (passed
activation and Microsoft WGA testing) but did not do the install from
original restore discs and nor did I supply them with the machine (legal
under EU law but contrary to the small print in the EULA which I did not
realise at the time). Buyer was an MS 'test purchaser" and 6 days before
Xmas I got a letter inviting me to pay them �2000 compensation to avoid
legal action. When I complained to Ebay they immediately closed down the
account of the 'buyer' which tells its own story.

There are a couple of follow up articles being written which essentially
slate MS for their bullying tactics against small dealers. I have been
interviewed by Channelweb at length for one of the follow ups as have a few
of the others on that list & apparently it's a similar story with others
too.

Happy to email a pdf of the letter I received to anyone interested, just
email me.


From: Fran on 11 Jul 2010 17:47

"Conor" <conor(a)gmx.co.uk> wrote in message
news:89uk8tFdvkU1(a)mid.individual.net...
> On 11/07/2010 20:01, Phister wrote:
>> Good article on uk.legal...Snowdon Computers gets a mention.
>>
>>
> I know Neil quite well.

But you don't know how to spell his name.


From: Phister on 13 Jul 2010 09:33
No critiscism Niel, just a "be-aware" item.
I remember your comments at the time.

Regards
--

DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT


 | 
Pages: 1
Prev: Original photo of different item?
Next: Turbo Lister, advice please