First  |  Prev |  Next  |  Last
Pages: 1 2 3 4 5 6 7 8 9 10 11 12 13
There's always one
Just bought a widget, fairly cheaply and informed the seller that payment would be through in a few days - PP and my bank between them conspire to delay things. This has never been a problem for any seller up until now. Got a whinging email this morning complaining about delay and how PP is supposed to be instant ... 5 Aug 2010 17:01
Furriners
Can an item be opened up to Europe if it already has UK bids? If so, howzat then? Si ... 13 Jul 2010 12:06
Turbo Lister, advice please
Here we go again, TL is giving me problems. It shuts down when I try and compact and back up or if I change to another user or if I synchronise, it probably shuts down with other things as well but never got that far. It basicall opens but I darent do anything after that but stare at the screen. I have arou... 13 Jul 2010 07:40
Watch out if you sell refurbished PC's.
Good article on uk.legal...Snowdon Computers gets a mention. -- DNA signature encryption key........ ATTGGTGCATTACTTCAGGCTCT ... 13 Jul 2010 09:51
Original photo of different item?
I'm currently the high bidder on this item http://cgi.ebay.co.uk/ws/eBayISAPI.dll?ViewItem&item=120592695027 As some people know, I have a soft spot for Yamaha thumpers, haviung owned several (two of which were XT600Es) and I want another. When I placed the bid, the only photo was the main pic used to illust... 12 Jul 2010 07:28
Lost parcel
Hi All, Long time no post from me. I need a bit of advice please. I sold a fairly heavy item, and due to work commitments, could not be around for courier collection, so decided to go RM Standard Parcels. In order to save cash, and as I assumed I was protected up to �41 anyway, I [stupidly] decided not to p... 20 Jul 2010 07:02
Extra feedback
Just left feedback for a seller. In addition to the comment and star ratings it also asked: How do you rate your experience with this seller? This extra question helps us evaluate our sellers. Your answer and comments do not appear on eBay. Then it allows me to rate the service on a scale from 0 (Awful) to ... 10 Jul 2010 09:29
postage for 12 invh vinyl
Anyone got a recent cost to post a 12 inch vinyl in card sleeve, approx 330 g Just not sure how it would be with the size, as in large letter or package. thanks ... 7 Jul 2010 14:39
$$$$$ Charity Shop Abuse $$$$$
I went into a charity shop today in London and was surprised to see them selling many lines of 'new' stock direct from factories. They only pay 10% of commercial council tax as they're registered charities. Isn't this a breach of law selling 'new' items? I really feel charity should begin at home and as they ha... 6 Jul 2010 03:36
faulty item / damaged in post
Grrrr Bought a pair of second hand CD decks last week on Ebay for 240 quid (plus 15 quid shipping). They arrived in the post this weekend and the seller had basically just chucked them in a box and put a bit of card inbetween them. No other protection/cushioning of any kind. One of the decks is faulty (it ... 5 Jul 2010 05:41
First  |  Prev |  Next  |  Last
Pages: 1 2 3 4 5 6 7 8 9 10 11 12 13